View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15188_low_10 (Length: 339)
Name: NF15188_low_10
Description: NF15188
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15188_low_10 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 106; Significance: 5e-53; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 106; E-Value: 5e-53
Query Start/End: Original strand, 50 - 163
Target Start/End: Complemental strand, 7196975 - 7196862
Alignment:
| Q |
50 |
ttaaaagttatagtggccgtttggaaccatgttgaaaaggtccgctaacaatgattatcttcccgctcaaaattgttgatttagacaacaacatttgaag |
149 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
7196975 |
ttaaaagttatagtggccgtttggaaccatgttgaaaaggtccgctaacactgattatcttccagctcaaaattgttgatttagacaacaacatttgaag |
7196876 |
T |
|
| Q |
150 |
aggtgtcctcttaa |
163 |
Q |
| |
|
|||||||||||||| |
|
|
| T |
7196875 |
aggtgtcctcttaa |
7196862 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 49; E-Value: 5e-19
Query Start/End: Original strand, 258 - 318
Target Start/End: Complemental strand, 7196720 - 7196661
Alignment:
| Q |
258 |
taacttgtcttcttggggctacatttatgttcatgttcatgcaagatcatattatagttta |
318 |
Q |
| |
|
||||||||||||||||| |||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
7196720 |
taacttgtcttcttggg-ctacatttatgttcatgtgcatgcaagatcatattatagttta |
7196661 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University