View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15188_low_13 (Length: 288)
Name: NF15188_low_13
Description: NF15188
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15188_low_13 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 217; Significance: 1e-119; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 217; E-Value: 1e-119
Query Start/End: Original strand, 7 - 271
Target Start/End: Complemental strand, 26216960 - 26216696
Alignment:
| Q |
7 |
ggagcacagaccctaacacaggcggccgaagtacagaaatgattttattctgtgatttgatgtgaaaatttgtgggcaatttttctaggttttactttcc |
106 |
Q |
| |
|
|||||||| ||||||||||||||||||||| |||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
26216960 |
ggagcacaaaccctaacacaggcggccgaaatacagaaatgcttttattctgtgatttgatgtgaaaatttgtgggcaatttttctagggtttactttcc |
26216861 |
T |
 |
| Q |
107 |
acccttctcttttttaatcaaacactaacctcgcttatttaattttccatctaacagatacctcccctctagataacaccgttcaacatctgttaaaata |
206 |
Q |
| |
|
| || |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| || |
|
|
| T |
26216860 |
atccctctcttttttaatcaaacactaacctcgcttatttaattttccatctaacagatacctcccctctagataacaccgtttaacatctgttaaagta |
26216761 |
T |
 |
| Q |
207 |
gatcgcagtcatttgcggtaggatattttggttgaactggtgtcattgacttggaagagatcttt |
271 |
Q |
| |
|
|||| |||||||||| | ||||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
26216760 |
gatcacagtcatttgtgctaggatattttggctgaactggtgtcattgacttggaagagatcttt |
26216696 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 209; E-Value: 1e-114
Query Start/End: Original strand, 7 - 271
Target Start/End: Complemental strand, 26229210 - 26228946
Alignment:
| Q |
7 |
ggagcacagaccctaacacaggcggccgaagtacagaaatgattttattctgtgatttgatgtgaaaatttgtgggcaatttttctaggttttactttcc |
106 |
Q |
| |
|
|||||||| |||||||||||||||||||| |||||||||| ||||||||||||||||||||||||||||||| ||||||||||||||| |||||||||| |
|
|
| T |
26229210 |
ggagcacaaaccctaacacaggcggccgagatacagaaatgcttttattctgtgatttgatgtgaaaatttgttggcaatttttctagggtttactttcc |
26229111 |
T |
 |
| Q |
107 |
acccttctcttttttaatcaaacactaacctcgcttatttaattttccatctaacagatacctcccctctagataacaccgttcaacatctgttaaaata |
206 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||| ||||||||||||| || |
|
|
| T |
26229110 |
acccctctcttttttaatcaaacactaacctcgcttatttaactttccatctaacagatacctcccctctagataacaccgtttaacatctgttaaagta |
26229011 |
T |
 |
| Q |
207 |
gatcgcagtcatttgcggtaggatattttggttgaactggtgtcattgacttggaagagatcttt |
271 |
Q |
| |
|
|||| |||||||||| | ||||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
26229010 |
gatcacagtcatttgtgctaggatattttggctgaactggtgtcattgacttggaagagatcttt |
26228946 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University