View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15188_low_16 (Length: 269)
Name: NF15188_low_16
Description: NF15188
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15188_low_16 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 162; Significance: 2e-86; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 162; E-Value: 2e-86
Query Start/End: Original strand, 1 - 264
Target Start/End: Complemental strand, 43143106 - 43142834
Alignment:
| Q |
1 |
taatgtaaatttagattttcttggtagattattttttcttgacagaatatataagtctagactctnnnnnnngtataagtctagattaaaatactcgcaa |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
43143106 |
taatgtaaatttagattttcttggtagattattttttcttgacagaatatataagtctagactctaaaaatagtataagtctagattaaaatactcgcaa |
43143007 |
T |
 |
| Q |
101 |
ttgcannnnnnnagaatttttctttcgttattgtcttattaacnnnnnnncttgaatatttttagtttataatattaaatatattttagctgacttttac |
200 |
Q |
| |
|
||||| ||| ||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43143006 |
ttgcatttttttagattttttctttcgttattgtcttattaacaaaaaaacttgaatatttttagtttataatattaaatatattttagctgacttttac |
43142907 |
T |
 |
| Q |
201 |
gaatattcagttacacttcacataa---------tacatcttctcaatcgatcctcttcctgattggcctttg |
264 |
Q |
| |
|
|||||||||||||||||||||||| |||||||||||||| ||||||||| |||||||||||||| |
|
|
| T |
43142906 |
taatattcagttacacttcacataataatacatctacatcttctcaattgatcctctttctgattggcctttg |
43142834 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University