View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1518_low_5 (Length: 230)
Name: NF1518_low_5
Description: NF1518
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1518_low_5 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 162; Significance: 1e-86; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 162; E-Value: 1e-86
Query Start/End: Original strand, 15 - 214
Target Start/End: Complemental strand, 9218996 - 9218796
Alignment:
| Q |
15 |
cataggcatgttatacatttaagcatataacgnnnnnnnnnttt-ataccagtatttatgtgcatatgtatgtctaaaaaggacaaacaactctacaagc |
113 |
Q |
| |
|
|||||||||||||||||||||||||||||||| ||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
9218996 |
cataggcatgttatacatttaagcatataacgaaaaaagaattttataccagtatttatgtgcatatgtatgtctaaaaaggacaaacaactctacaagc |
9218897 |
T |
 |
| Q |
114 |
tgtacaatgtatatatatgcttctacacaactatctttgttactttctgtcaaaagcattaactaggttgatcagattcactataaccagatgcttgtgc |
213 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
9218896 |
tgtacaatgtatatatatgcttctacacaactatctttgttactttctgtcaaaagcattaactaggttgatcagattcactataaccagacgcttgtgc |
9218797 |
T |
 |
| Q |
214 |
c |
214 |
Q |
| |
|
| |
|
|
| T |
9218796 |
c |
9218796 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University