View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15192_high_28 (Length: 281)
Name: NF15192_high_28
Description: NF15192
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15192_high_28 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 206; Significance: 1e-113; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 206; E-Value: 1e-113
Query Start/End: Original strand, 18 - 276
Target Start/End: Complemental strand, 36572023 - 36571756
Alignment:
| Q |
18 |
agagatatcgagtagtcaaatgaaaatagttgaaaggtcgtttcagatcacaaactacagtttatccagcagaaggaagggtggtgaatgta---atgta |
114 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
36572023 |
agagagatcgagtagtcaaatgaaaatagttgaaaggtcgtttctgatcacaaactacagtttatccagcagaaggaagggtggtgaatgtagtaatgta |
36571924 |
T |
 |
| Q |
115 |
ttcatatcagtatatgttaccaatcaccctaaccaacacaaattgggctccacaatgcacactcccagttttcatttattc-----atttctacatatat |
209 |
Q |
| |
|
||||||||||||||||||||||||||||| |||||||||||||||||||||||| |||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
36571923 |
ttcatatcagtatatgttaccaatcaccccaaccaacacaaattgggctccacattgcacactcccagttttcatttattcatttaatttctacatatat |
36571824 |
T |
 |
| Q |
210 |
atttttcacc-ttttgcccatctctctcttataaagctgcaaacgagatctatccacttcatctcagt |
276 |
Q |
| |
|
|||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
36571823 |
atttttcacctttttgcccatctctctcttataaagctgcaaacgagatctatccacttcatcacagt |
36571756 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University