View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15192_high_30 (Length: 276)
Name: NF15192_high_30
Description: NF15192
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15192_high_30 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 200; Significance: 1e-109; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 200; E-Value: 1e-109
Query Start/End: Original strand, 1 - 266
Target Start/End: Original strand, 5395981 - 5396231
Alignment:
| Q |
1 |
cgtttttattatattaatattatttgagaaatgccgacgagtgcccctagagcactcaggaccttaaaaggtaagtttttataaaagtttccgtatccaa |
100 |
Q |
| |
|
|||||||||||||||||||||||||| |||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5395981 |
cgtttttattatattaatattatttgggaaatgccaacgagtgcccctagagcactcaggaccttaaaaggtaagtttttataaaagtttccgtatccaa |
5396080 |
T |
|
| Q |
101 |
tatatcgaaaattgtgatatttgacttttttataagaatattttcttaaagtaaaatgcttaacgaatgatccgaaaacactcgttaacaagaccttatt |
200 |
Q |
| |
|
||||| | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5396081 |
tatattggaaattgtgatatttgacttttttataagaatattttcttaaagtaaaatgcttaacgaatgatccgaaaacactcgttaacaagacc----- |
5396175 |
T |
|
| Q |
201 |
atttttactactgctattcagtttaagggtcccttaccctggtccaattgtccacccttacctttg |
266 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5396176 |
----------ctgctattcagtttaagggtcccttaccctggtccaattgtccacccttacctttg |
5396231 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 48; E-Value: 2e-18
Query Start/End: Original strand, 203 - 266
Target Start/End: Original strand, 5392280 - 5392343
Alignment:
| Q |
203 |
ttttactactgctattcagtttaagggtcccttaccctggtccaattgtccacccttacctttg |
266 |
Q |
| |
|
|||||||| | |||||||||||||||||||||||||| | |||||||||||||||||||||||| |
|
|
| T |
5392280 |
ttttactattactattcagtttaagggtcccttaccccgatccaattgtccacccttacctttg |
5392343 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 34; Significance: 0.0000000004; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 142 - 198
Target Start/End: Complemental strand, 14166653 - 14166597
Alignment:
| Q |
142 |
tttcttaaagtaaaatgcttaacgaatgatcc-gaaaacactcgttaacaagacctta |
198 |
Q |
| |
|
|||||||||||||||||||||| |||| |||| |||| |||||||||||||||||||| |
|
|
| T |
14166653 |
tttcttaaagtaaaatgcttaaagaat-atcctgaaagcactcgttaacaagacctta |
14166597 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University