View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15192_high_31 (Length: 276)
Name: NF15192_high_31
Description: NF15192
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15192_high_31 |
 |  |
|
| [»] scaffold0140 (2 HSPs) |
 |  |  |
|
Alignment Details
Target: scaffold0140 (Bit Score: 140; Significance: 2e-73; HSPs: 2)
Name: scaffold0140
Description:
Target: scaffold0140; HSP #1
Raw Score: 140; E-Value: 2e-73
Query Start/End: Original strand, 100 - 254
Target Start/End: Original strand, 33326 - 33481
Alignment:
| Q |
100 |
gctctaaaatcatatatcatgttttggctaaaccaattagaatcctttgtcatttgcacttgtagactttgcttatagaaaatgattttatgt-caaaaa |
198 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| | |||||| |
|
|
| T |
33326 |
gctctaaaatcatatatcatgttttggctaaaccaattagactcctttgtcatttgcacttgtagactttgcttatagaaaatgattttatatacaaaaa |
33425 |
T |
 |
| Q |
199 |
accgtgttatgacttttgtgttttttctttagaaatatgtgtaaattgaaggagtt |
254 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33426 |
accgtgttatgacttttgtgttttttctttagaaatatgtgtaaattgaaggagtt |
33481 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0140; HSP #2
Raw Score: 49; E-Value: 4e-19
Query Start/End: Original strand, 15 - 63
Target Start/End: Original strand, 33239 - 33287
Alignment:
| Q |
15 |
cataggccagctatagaacagagaggatacaaagcgaccttaactagtg |
63 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33239 |
cataggccagctatagaacagagaggatacaaagcgaccttaactagtg |
33287 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University