View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15192_high_34 (Length: 263)
Name: NF15192_high_34
Description: NF15192
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15192_high_34 |
 | |
|
| [»] chr1 (2 HSPs) |
| |
|
Alignment Details
Target: chr1 (Bit Score: 150; Significance: 2e-79; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 150; E-Value: 2e-79
Query Start/End: Original strand, 102 - 263
Target Start/End: Original strand, 24620632 - 24620793
Alignment:
| Q |
102 |
caagttgcctagattccttactagtaacttgggatgggaaactgactacgaagtctctatttcaaggcaatcttgatgctcaaatgcgatgaagtaccaa |
201 |
Q |
| |
|
||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
24620632 |
caagttgcctagattccttactagtaacttgtgatgggaaactgactacgaagtctctatttcaaggcaatcttgatgctcaaatgcgatgaagtaccaa |
24620731 |
T |
|
| Q |
202 |
tatagacaagacacgtgaacactagtaataaaatatgaaaatagaagtaagtgaatgtaatt |
263 |
Q |
| |
|
|| |||||||||| |||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
24620732 |
taaagacaagacatgtgaacactagtaataaaatatgaaaatagaagtaagtgaatgtaatt |
24620793 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 121 - 187
Target Start/End: Complemental strand, 4745673 - 4745607
Alignment:
| Q |
121 |
actagtaacttgggatgggaaactgactacgaagtctctatttcaaggcaatcttgatgctcaaatg |
187 |
Q |
| |
|
|||||||||||| |||||||||| |||||||||||| ||||||||||||| ||||| || ||||||| |
|
|
| T |
4745673 |
actagtaacttgtgatgggaaaccgactacgaagtccctatttcaaggcattcttggtggtcaaatg |
4745607 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University