View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15192_high_36 (Length: 256)
Name: NF15192_high_36
Description: NF15192
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15192_high_36 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 124; Significance: 7e-64; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 124; E-Value: 7e-64
Query Start/End: Original strand, 12 - 162
Target Start/End: Original strand, 38075081 - 38075232
Alignment:
| Q |
12 |
aagaaaaagaatagaacctcacccacttgtgaaactcaaaatggttagaataaaattatatattatattaaaac-aggagaacattgtcatgttgatagc |
110 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| ||||| |||||||||| |||||||| |
|
|
| T |
38075081 |
aagaaaaagaatagaacctcacccacttgtgaaactcaaaatggttagaataaaattatatattatattgaaacaaggagtacattgtcattttgatagc |
38075180 |
T |
 |
| Q |
111 |
ttaaccaaggtcatgcgttgaattcagtcttaaatatacagtaacgttaaaa |
162 |
Q |
| |
|
||||||||| |||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38075181 |
ttaaccaagatcatacgttgaattcagtcttaaatatacagtaacgttaaaa |
38075232 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University