View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15192_high_46 (Length: 223)
Name: NF15192_high_46
Description: NF15192
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15192_high_46 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 63; Significance: 2e-27; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 63; E-Value: 2e-27
Query Start/End: Original strand, 46 - 120
Target Start/End: Complemental strand, 30900102 - 30900028
Alignment:
| Q |
46 |
gttaacaattgtctttatggcacttaaggacatttgttatgaatttgaaaatggaaacaacagataactttatgt |
120 |
Q |
| |
|
||||||||||||||||| |||||||||||||| |||||||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
30900102 |
gttaacaattgtctttagggcacttaaggacacttgttatgaatttgaaaatggaaacaactgataactttatgt |
30900028 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 161 - 207
Target Start/End: Complemental strand, 30899388 - 30899342
Alignment:
| Q |
161 |
cagtgagtaccatcatcccgaaaaatttatgagggttcgattatttt |
207 |
Q |
| |
|
|||||| |||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
30899388 |
cagtgactaccatcaccccgaaaaatttatgagggttcgattatttt |
30899342 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University