View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15192_high_47 (Length: 220)
Name: NF15192_high_47
Description: NF15192
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15192_high_47 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 162; Significance: 1e-86; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 162; E-Value: 1e-86
Query Start/End: Original strand, 47 - 212
Target Start/End: Complemental strand, 35792068 - 35791903
Alignment:
| Q |
47 |
ttctaaataattagtaatagtatgatgcagtgcaatcactgttattttcatttttggaaaaatgtggattacaatgtaattcacgggacccttttgctta |
146 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35792068 |
ttctaaataattagtaatagtatgatgcagtgcaatcactgctattttcatttttggaaaaatgtggattacaatgtaattcacgggacccttttgctta |
35791969 |
T |
 |
| Q |
147 |
actaaaaacctacccccctatcatcaaaatttaatggcaaaacaccaaatgatatgtatcctttgc |
212 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35791968 |
actaaaaacctacccccctatcatcaaaatttaatggcaaaacaccaaatgatatgtatcctttgc |
35791903 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 40; E-Value: 0.00000000000008
Query Start/End: Original strand, 16 - 55
Target Start/End: Complemental strand, 35792262 - 35792223
Alignment:
| Q |
16 |
atctacacatttactatttataatttcattattctaaata |
55 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35792262 |
atctacacatttactatttataatttcattattctaaata |
35792223 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University