View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15192_low_13 (Length: 410)
Name: NF15192_low_13
Description: NF15192
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15192_low_13 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 217; Significance: 1e-119; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 217; E-Value: 1e-119
Query Start/End: Original strand, 23 - 243
Target Start/End: Complemental strand, 46236328 - 46236108
Alignment:
| Q |
23 |
agatcaatcttgacacacttcactacacttgaaggatctgctgataattcatttccagtttcaaccctacttgaactaaccatttctttcatcttatctc |
122 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
46236328 |
agatcaatcttgacacacttcactacacttgaaggatctgctgataattcatttccagtttcaaccctacttgaactaaccatttctttcattttatctc |
46236229 |
T |
|
| Q |
123 |
tctttatttcaagttcattaattttctgcttcaaaatttgtacataatttgcagcctcacctatgtgatctgatactgaacgcttaccctaaaagcaaag |
222 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46236228 |
tctttatttcaagttcattaattttctgcttcaaaatttgtacataatttgcagcctcacctatgtgatctgatactgaacgcttaccctaaaagcaaag |
46236129 |
T |
|
| Q |
223 |
aaagatgttgtgaaaactacg |
243 |
Q |
| |
|
||||||||||||||||||||| |
|
|
| T |
46236128 |
aaagatgttgtgaaaactacg |
46236108 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 71; E-Value: 5e-32
Query Start/End: Original strand, 325 - 399
Target Start/End: Complemental strand, 46236027 - 46235953
Alignment:
| Q |
325 |
gaccttgatgagatcaaaaggaattgaagaacggagtgatgaacatagaatagacatttgcatcctcctttgctt |
399 |
Q |
| |
|
||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46236027 |
gaccttgatgagatcaaaaggaagtgaagaacggagtgatgaacatagaatagacatttgcatcctcctttgctt |
46235953 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University