View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15192_low_16 (Length: 398)
Name: NF15192_low_16
Description: NF15192
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15192_low_16 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 77; Significance: 1e-35; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 77; E-Value: 1e-35
Query Start/End: Original strand, 273 - 382
Target Start/End: Original strand, 7212913 - 7213032
Alignment:
| Q |
273 |
acctccctcttcctttgtcgtgccacactgtaaaactctcatctctctcgtcctttgcctttg----------atgtccaatctccgccgccaaaagctt |
362 |
Q |
| |
|
|||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||| |||||| |||||||||||||||||||| |
|
|
| T |
7212913 |
acctccctcttcctttgtcgcgccacactgtaaaactctcatctctctcgtcctttgcctttgccacgaatttatgtccgatctccgccgccaaaagctt |
7213012 |
T |
|
| Q |
363 |
tgtttccggtcaccctcgtg |
382 |
Q |
| |
|
|||||||||||||||||||| |
|
|
| T |
7213013 |
tgtttccggtcaccctcgtg |
7213032 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University