View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15192_low_26 (Length: 317)
Name: NF15192_low_26
Description: NF15192
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15192_low_26 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 168; Significance: 5e-90; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 168; E-Value: 5e-90
Query Start/End: Original strand, 110 - 301
Target Start/End: Complemental strand, 6994233 - 6994042
Alignment:
| Q |
110 |
aggggtgggtcgtggcccacctaaacccacacaatgctccgccattgcagtcaataatttgtggcataagcaattctctaaactttcttatttccatggg |
209 |
Q |
| |
|
||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| ||||||||||||||| |||||||||||||||||||||||| | |
|
|
| T |
6994233 |
aggggtgggtcgtggcccacctaaacccacacagtgctccgccattgcagtcaataacttgtggcataagcaactctctaaactttcttatttccatgag |
6994134 |
T |
 |
| Q |
210 |
taatggtagtagtaaactttagttaataacaaattgttcaaaagaatctgaatttgactactagtttaaacctcaattgtgcactagttttt |
301 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |||||||| |
|
|
| T |
6994133 |
taatggtagtagtaaactttagttaataacaaattgttcaaaagaatctgaatttgactactagtttaaacctcaatggtgcattagttttt |
6994042 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University