View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15192_low_28 (Length: 313)
Name: NF15192_low_28
Description: NF15192
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15192_low_28 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 190; Significance: 1e-103; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 190; E-Value: 1e-103
Query Start/End: Original strand, 1 - 282
Target Start/End: Original strand, 50243261 - 50243543
Alignment:
| Q |
1 |
atacacctacacatgttagacattgaacatgctttcaatctcaagtgtcggggcgatatagttgttacttattattattgttgtgacagacaacgaaata |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||| |||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
50243261 |
atacacctacacatgttagacattgaacatgttttcaatctcaagtgtcgggccgatatagttgttacttattattattgttgtgacagacaacgaaata |
50243360 |
T |
 |
| Q |
101 |
ctatgtgaatttcnnnnnnnnnngtttt---gaaatatgtctttgtttaatgaaaaagttaacnnnnnnnnctttctgagattaggtgcaacccttaaca |
197 |
Q |
| |
|
||||||||||||| |||| ||||| ||||||||||||||||||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
50243361 |
ctatgtgaatttctttcttttttttttttttgaaat--gtctttgtttaatgaaaaagttaacttttttttctttctgagattaggtgcaacccttaaca |
50243458 |
T |
 |
| Q |
198 |
aagggttcaatcgtgctttgggaacgatttcagcaggagtgcttgctatagggattgcacgattatcagttttagttggtggagc |
282 |
Q |
| |
|
||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
50243459 |
aagggttcaatcgtgctttgggaacaatttcagcaggagtgcttgctatagggattgcacgattatcagttttagttggtggagc |
50243543 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 29; Significance: 0.0000004; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 13 - 49
Target Start/End: Complemental strand, 3963755 - 3963719
Alignment:
| Q |
13 |
atgttagacattgaacatgctttcaatctcaagtgtc |
49 |
Q |
| |
|
|||||||||||||||||||| |||||||| ||||||| |
|
|
| T |
3963755 |
atgttagacattgaacatgccttcaatctaaagtgtc |
3963719 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University