View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15192_low_40 (Length: 257)
Name: NF15192_low_40
Description: NF15192
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15192_low_40 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 217; Significance: 1e-119; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 217; E-Value: 1e-119
Query Start/End: Original strand, 17 - 237
Target Start/End: Complemental strand, 29701047 - 29700827
Alignment:
| Q |
17 |
ttgtttgataaaatggttttgatagttgctttgacatgaggtatgagactctccaaaaaagtcaagatgtaaaattctggagattttagtagctcttgtg |
116 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29701047 |
ttgtttgataaaatggttttgatagttgctttgacatgaggtatgagactctccaaaaaagtcaagatgtaaaattctggagattttagtagctcttgtg |
29700948 |
T |
|
| Q |
117 |
gaggtggttctacttcaggaagatcaatgagttgaatttgtggttgtgaggctaaaactgatttgatatatgaatctgcaaagggcatgcctggaaactt |
216 |
Q |
| |
|
|||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29700947 |
gaggtggttctacttcaggaagatcaatcagttgaatttgtggttgtgaggctaaaactgatttgatatatgaatctgcaaagggcatgcctggaaactt |
29700848 |
T |
|
| Q |
217 |
gatgcagaagactgtgatgta |
237 |
Q |
| |
|
||||||||||||||||||||| |
|
|
| T |
29700847 |
gatgcagaagactgtgatgta |
29700827 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 110 - 235
Target Start/End: Complemental strand, 29678494 - 29678369
Alignment:
| Q |
110 |
tcttgtggaggtggttctacttcaggaagatcaatgagttgaatttgtggttgtgaggctaaaactgatttgatatatgaatctgcaaagggcatgcctg |
209 |
Q |
| |
|
|||| ||| |||| ||| |||| ||||||||||||||||| ||||| |||||| || ||||||||||||||| |||||||||| ||| || | || |
|
|
| T |
29678494 |
tcttttggtggtgattcaacttgaggaagatcaatgagtttgatttgaggttgtaagtttaaaactgatttgatgtatgaatctgaaaatggtgtatgtg |
29678395 |
T |
|
| Q |
210 |
gaaacttgatgcagaagactgtgatg |
235 |
Q |
| |
|
|||| |||||||| | |||||||||| |
|
|
| T |
29678394 |
gaaatttgatgcaaaggactgtgatg |
29678369 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University