View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF15192_low_51 (Length: 223)

Name: NF15192_low_51
Description: NF15192
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF15192_low_51
NF15192_low_51
[»] chr2 (2 HSPs)
chr2 (46-120)||(30900028-30900102)
chr2 (161-207)||(30899342-30899388)


Alignment Details
Target: chr2 (Bit Score: 63; Significance: 2e-27; HSPs: 2)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 63; E-Value: 2e-27
Query Start/End: Original strand, 46 - 120
Target Start/End: Complemental strand, 30900102 - 30900028
Alignment:
46 gttaacaattgtctttatggcacttaaggacatttgttatgaatttgaaaatggaaacaacagataactttatgt 120  Q
    ||||||||||||||||| |||||||||||||| |||||||||||||||||||||||||||| |||||||||||||    
30900102 gttaacaattgtctttagggcacttaaggacacttgttatgaatttgaaaatggaaacaactgataactttatgt 30900028  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #2
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 161 - 207
Target Start/End: Complemental strand, 30899388 - 30899342
Alignment:
161 cagtgagtaccatcatcccgaaaaatttatgagggttcgattatttt 207  Q
    |||||| |||||||| |||||||||||||||||||||||||||||||    
30899388 cagtgactaccatcaccccgaaaaatttatgagggttcgattatttt 30899342  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University