View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15192_low_53 (Length: 206)
Name: NF15192_low_53
Description: NF15192
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15192_low_53 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 166; Significance: 5e-89; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 166; E-Value: 5e-89
Query Start/End: Original strand, 19 - 184
Target Start/End: Original strand, 6292109 - 6292274
Alignment:
| Q |
19 |
caaaggcgaaatctctagcatgatgtaccaatttttgaacttcttgcaaacaacaaaagcacctttttggatcaatgcttacccttactttgcatataaa |
118 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6292109 |
caaaggcgaaatctctagcatgatgtaccaatttttgaacttcttgcaaacaacaaaagcacctttttggatcaatgcttacccttactttgcatataaa |
6292208 |
T |
|
| Q |
119 |
gatgatccagattcaattcctttggactatgttttatttaatcctagtcaaggaatggttgatcct |
184 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6292209 |
gatgatccagattcaattcctttggactatgttttatttaatcctagtcaaggaatggttgatcct |
6292274 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 45; Significance: 8e-17; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 45; E-Value: 8e-17
Query Start/End: Original strand, 48 - 184
Target Start/End: Complemental strand, 32856688 - 32856552
Alignment:
| Q |
48 |
aatttttgaacttcttgcaaacaacaaaagcacctttttggatcaatgcttacccttactttgcatataaagatgatccagattcaattcctttggacta |
147 |
Q |
| |
|
||||||||||||| ||| || ||||||| |||| |||||| |||||||||| ||||| ||||| ||||| |||| || || ||| |||| ||||| |
|
|
| T |
32856688 |
aatttttgaactttttgtcaaaaacaaaatcacccttttgggtcaatgcttatccttattttgcttataagaatgaccctaatcaaatatctttagacta |
32856589 |
T |
|
| Q |
148 |
tgttttatttaatcctagtcaaggaatggttgatcct |
184 |
Q |
| |
|
||| ||||||||||||| |||||||||||||||||| |
|
|
| T |
32856588 |
tgtattatttaatcctaaccaaggaatggttgatcct |
32856552 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University