View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15193_high_13 (Length: 247)
Name: NF15193_high_13
Description: NF15193
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15193_high_13 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 179; Significance: 1e-96; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 179; E-Value: 1e-96
Query Start/End: Original strand, 64 - 246
Target Start/End: Original strand, 18685058 - 18685240
Alignment:
| Q |
64 |
tgtgtttgtgacaaaatattgattttgcagacttgtgagggtactttcgatcttcctgatctctcggacgatttctccttgaatttgttagattggggct |
163 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
18685058 |
tgtgtttgtgacaaaatattgattttgcagacttgtgagggtactttcgatcttcctgatctctcggacgatttctccttgaatttgttagattggggct |
18685157 |
T |
|
| Q |
164 |
cacgtaatgtccttagcatcgcacttgatcataccatttatttttggaatgcctcggatagttccgggtctgaacttgtcact |
246 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
18685158 |
cacgtaatgtccttagcatcgcacttgatcataccatttatttttggaatgcctcggatagttccgggtctgaatttgtcact |
18685240 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 37; E-Value: 0.000000000006
Query Start/End: Original strand, 1 - 41
Target Start/End: Original strand, 18685016 - 18685056
Alignment:
| Q |
1 |
tattctttcagttgtttgtagttagttatatgccatttttt |
41 |
Q |
| |
|
|||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
18685016 |
tattctttcaattgtttgtagttagttatatgccatttttt |
18685056 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University