View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15194_low_10 (Length: 239)
Name: NF15194_low_10
Description: NF15194
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15194_low_10 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 129; Significance: 7e-67; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 129; E-Value: 7e-67
Query Start/End: Original strand, 60 - 220
Target Start/End: Original strand, 27390719 - 27390878
Alignment:
| Q |
60 |
gtatgtaccttactcaaaaattaagagtgtagatcaggacacattgatgcctcgtgggaagaatttattgcccataggtgacaaggatatgtttgtttaa |
159 |
Q |
| |
|
||||||| ||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| | |
|
|
| T |
27390719 |
gtatgtaacttactcaaaaattaagagtgtagatcagaacacattgatgcctcgtgggaagaatttattgcccataggtgacaaggatatgttggttt-a |
27390817 |
T |
|
| Q |
160 |
ggtcaaatgatgcctccatgttgcttgcttcaaataccctcaaacaccttttttctcctat |
220 |
Q |
| |
|
|| ||||||||||||||| |||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
27390818 |
ggccaaatgatgcctccacgttgcttgcttcaaataccctcaaacaccttttttcccctat |
27390878 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 127; E-Value: 1e-65
Query Start/End: Original strand, 68 - 221
Target Start/End: Original strand, 27384237 - 27384390
Alignment:
| Q |
68 |
cttactcaaaaattaagagtgtagatcaggacacattgatgcctcgtgggaagaatttattgcccataggtgacaaggatatgtttgtttaaggtcaaat |
167 |
Q |
| |
|
||||||||||| |||| |||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
27384237 |
cttactcaaaatttaa-agtgtagatcagaacacattgatgcctcgtgggaagaatttattgcccataggtgacaaggatatgtttgtttaaggtcaaat |
27384335 |
T |
|
| Q |
168 |
gatgcctccatgttgcttgcttcaaataccctcaaacacc-ttttttctcctatg |
221 |
Q |
| |
|
|||||||||| ||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
27384336 |
gatgcctccacgttgcttgcttcaaataccctcaaacacctttttttctcctatg |
27384390 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University