View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15195_high_43 (Length: 255)
Name: NF15195_high_43
Description: NF15195
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15195_high_43 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 158; Significance: 4e-84; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 158; E-Value: 4e-84
Query Start/End: Original strand, 54 - 233
Target Start/End: Complemental strand, 5948364 - 5948188
Alignment:
| Q |
54 |
tcatttattcttcaagttctaattagtaattcgtccaggtggaggaaagattgatttataaagttacactaaatgcatgtcttttgacaatacgggaata |
153 |
Q |
| |
|
|||||||||||||||||||||| |||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5948364 |
tcatttattcttcaagttctaa---gtaactcgtccaggtggaggaaagattgatttataaagttacactaaatgcatgtcttttgacaatacgggaata |
5948268 |
T |
|
| Q |
154 |
aataggtgaaataaaccgaattcgaagggtcaaacaccaatgatgattagaccacaaagagcaatttaagtctgtcgaca |
233 |
Q |
| |
|
||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5948267 |
aattggtgaaataaaccgaattcgaagggtcaaacaccaatgatgattagaccacaaagagcaatttaagtctgtcgaca |
5948188 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University