View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF15195_high_43 (Length: 255)

Name: NF15195_high_43
Description: NF15195
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF15195_high_43
NF15195_high_43
[»] chr1 (1 HSPs)
chr1 (54-233)||(5948188-5948364)


Alignment Details
Target: chr1 (Bit Score: 158; Significance: 4e-84; HSPs: 1)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 158; E-Value: 4e-84
Query Start/End: Original strand, 54 - 233
Target Start/End: Complemental strand, 5948364 - 5948188
Alignment:
54 tcatttattcttcaagttctaattagtaattcgtccaggtggaggaaagattgatttataaagttacactaaatgcatgtcttttgacaatacgggaata 153  Q
    ||||||||||||||||||||||   |||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
5948364 tcatttattcttcaagttctaa---gtaactcgtccaggtggaggaaagattgatttataaagttacactaaatgcatgtcttttgacaatacgggaata 5948268  T
154 aataggtgaaataaaccgaattcgaagggtcaaacaccaatgatgattagaccacaaagagcaatttaagtctgtcgaca 233  Q
    ||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
5948267 aattggtgaaataaaccgaattcgaagggtcaaacaccaatgatgattagaccacaaagagcaatttaagtctgtcgaca 5948188  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University