View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15195_high_48 (Length: 240)
Name: NF15195_high_48
Description: NF15195
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15195_high_48 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 147; Significance: 1e-77; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 147; E-Value: 1e-77
Query Start/End: Original strand, 1 - 155
Target Start/End: Complemental strand, 43906867 - 43906713
Alignment:
| Q |
1 |
ctttttggtttcaacaatccttgaaacattttcactctgagaaagaattgtattgaaacaggatccaaattaatgaggatgttaattgctatgttgaggt |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
43906867 |
ctttttggtttcaacaatccttgaaacattttcactctgagaaagaattgtattgaaacaggatccaaattaatgaggatgttaattgctatgtaaaggt |
43906768 |
T |
|
| Q |
101 |
gaaaatgaaaaataggctgaaaataagaatgaacgttaaccttatataatatgtg |
155 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43906767 |
gaaaatgaaaaataggctgaaaataagaatgaacgttaaccttatataatatgtg |
43906713 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University