View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15195_high_51 (Length: 239)
Name: NF15195_high_51
Description: NF15195
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15195_high_51 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 234; Significance: 1e-129; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 234; E-Value: 1e-129
Query Start/End: Original strand, 1 - 238
Target Start/End: Complemental strand, 40421427 - 40421190
Alignment:
| Q |
1 |
tgaaagataatgttccaagtttgattggtgagaatattgagaagagtctagaagaaacttttcatccattgggaattactgattggaattctttgttttg |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40421427 |
tgaaagataatgttccaagtttgattggtgagaatattgagaagagtctagaagaaacttttcatccattgggaattactgattggaattctttgttttg |
40421328 |
T |
|
| Q |
101 |
ggtaacacaccccggcggtcctgcaataatcaagaggatcgaagaaacggttgggttgaattcagataaactaaatgcaactaaacatgttttgagtgag |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40421327 |
ggtaacacaccccggcggtcctgcaataatcaagaggattgaagaaacggttgggttgaattcagataaactaaatgcaactaaacatgttttgagtgag |
40421228 |
T |
|
| Q |
201 |
tatggaaacatgtcaagtgcttgtgtgatatttatatt |
238 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40421227 |
tatggaaacatgtcaagtgcttgtgtgatatttatatt |
40421190 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University