View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15195_high_52 (Length: 235)
Name: NF15195_high_52
Description: NF15195
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15195_high_52 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 125; Significance: 2e-64; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 125; E-Value: 2e-64
Query Start/End: Original strand, 1 - 129
Target Start/End: Complemental strand, 36532959 - 36532831
Alignment:
| Q |
1 |
taatttaagatcaatgttttagtgatagcaattgaaattatccaagaataatcaagtaaattatcatgtgcatatgagaatattaagtggttatagttta |
100 |
Q |
| |
|
|||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36532959 |
taatttaagatcaaagttttagtgatagcaattgaaattatccaagaataatcaagtaaattatcatgtgcatatgagaatattaagtggttatagttta |
36532860 |
T |
 |
| Q |
101 |
gctacctatgataaaatacagatatgagg |
129 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
36532859 |
gctacctatgataaaatacagatatgagg |
36532831 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 88; E-Value: 2e-42
Query Start/End: Original strand, 126 - 221
Target Start/End: Complemental strand, 36532788 - 36532693
Alignment:
| Q |
126 |
gaggttaggagacctgcaactgcaaggtcctttttggttagtaccatctttctagaacctctggtacaaaatatcagtcttctttgactaacattt |
221 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| ||||||| |
|
|
| T |
36532788 |
gaggttaggagacctgcaactgcaaggtcctttttggttagtaccatctttctagaacctctagtacaaaatatcagtcttctttgaccaacattt |
36532693 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University