View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15195_high_55 (Length: 231)
Name: NF15195_high_55
Description: NF15195
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15195_high_55 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 194; Significance: 1e-105; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 194; E-Value: 1e-105
Query Start/End: Original strand, 18 - 215
Target Start/End: Complemental strand, 4394160 - 4393963
Alignment:
| Q |
18 |
gatggtggaggaagtagtaggatgtaaaacagtagtagtagttgtggcgggtggcaaacagatgttcagatgtggggggatttggtgcattattttcacg |
117 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4394160 |
gatggtggaggaagtagtaggatgtaaaacagtagtagtagttgtggcgggtggcaaacagatgttcagatgtggggggatttggtgcattattttcaca |
4394061 |
T |
 |
| Q |
118 |
gacttatcctgttcttgatctttctttgaggaattaacaccatggttgttcatgatctcactaagcaggaaactggtagtgcaattaccagtgttatg |
215 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4394060 |
gacttatcctgttcttgatctttctttgaggaattaacaccatggttgttcatgatctcactaagcaggaaactggtagtgcaattaccagtgttatg |
4393963 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University