View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15195_high_58 (Length: 210)
Name: NF15195_high_58
Description: NF15195
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15195_high_58 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 168; Significance: 3e-90; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 168; E-Value: 3e-90
Query Start/End: Original strand, 14 - 193
Target Start/End: Original strand, 30702116 - 30702295
Alignment:
| Q |
14 |
caaaggaaaaaatgcagtgaaaattgcatattggcaccatactttccatcaagcagaagaagagaattcaaagcagtgcacaaagtgtttggtgttagca |
113 |
Q |
| |
|
|||||||||||||||||||||||||||||||| ||||||||||||||||||| |||||| |||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30702116 |
caaaggaaaaaatgcagtgaaaattgcatattagcaccatactttccatcaaacagaagtagagaattcaaagcagtgcacaaagtgtttggtgttagca |
30702215 |
T |
 |
| Q |
114 |
acataacaaagtttgtaaggaatgctcaagagggagatagaagaaaagttgtggattcattgatatgggaagcactttct |
193 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30702216 |
acataacaaagtttgtaaggaatgctcaagagggagatagaagaaaagttgtggattcattgatatgggaagcactttct |
30702295 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University