View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15195_high_59 (Length: 205)
Name: NF15195_high_59
Description: NF15195
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15195_high_59 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 170; Significance: 2e-91; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 170; E-Value: 2e-91
Query Start/End: Original strand, 14 - 191
Target Start/End: Complemental strand, 41240800 - 41240623
Alignment:
| Q |
14 |
caaagggactatttcattctcaattttgcattgtacaagattggtatatttaaatgtatctaataataaattgagtggtaggtttccaaataaggcttta |
113 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
41240800 |
caaagggactatttcattctcaattttgcattgtacaagattggtatatttaaatgtatccaataatcaattgagtggtaggtttccaaataaggcttta |
41240701 |
T |
|
| Q |
114 |
acaagattgaaatatcttacgaacttagatgtatctatgaataatttttctactagttacatggctccaattagtatt |
191 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41240700 |
acaagattgaaatatcttacgaacttagatgtatctatgaataatttttctactagttacatggctccaattagtatt |
41240623 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University