View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15195_low_27 (Length: 383)
Name: NF15195_low_27
Description: NF15195
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15195_low_27 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 172; Significance: 2e-92; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 172; E-Value: 2e-92
Query Start/End: Original strand, 31 - 210
Target Start/End: Complemental strand, 26787550 - 26787371
Alignment:
| Q |
31 |
gaaggattcatatagaattaatctcaataattaatacttttcatttaaaaatatagaattctattttatgaaagaagtaataaattcaaactttgtagat |
130 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
26787550 |
gaaggattcatatagaattaatctcaataattaatacttttcaattaaaaatatagaattctattttatgaaagaagtaataaattcaaactttgtagat |
26787451 |
T |
|
| Q |
131 |
ttcagttcatccttttaaagaatttcattattgatagaaaatagatagtttttcaaatatattttactattatttttaac |
210 |
Q |
| |
|
|| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
26787450 |
tttagttcatccttttaaagaatttcattattgatagaaaatagatagtttttcaaatatattttactattatttttaac |
26787371 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 82; E-Value: 1e-38
Query Start/End: Original strand, 270 - 367
Target Start/End: Complemental strand, 26787311 - 26787214
Alignment:
| Q |
270 |
ggagatcaactcgtgcaacgaacttaagagatgaatttgggtattttttgcgtgtcaaatgaaagtcaaaacgctgccgcatgtctaagtctagttca |
367 |
Q |
| |
|
||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||| | ||||||||||| |||||||||||||||||||||| |
|
|
| T |
26787311 |
ggagatcaactcgtgcaacgaacttaaaagatgaatttgggtattttttgcgtgtcaaatggacgtcaaaacgctaccgcatgtctaagtctagttca |
26787214 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University