View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15195_low_35 (Length: 328)
Name: NF15195_low_35
Description: NF15195
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15195_low_35 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 290; Significance: 1e-163; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 290; E-Value: 1e-163
Query Start/End: Original strand, 13 - 314
Target Start/End: Complemental strand, 32095514 - 32095213
Alignment:
| Q |
13 |
aatatatgatcttttttattcttacaaagcataaaattacaaagagaactctttatgggagatcaacggctattattattataaaattaattaacccctt |
112 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32095514 |
aatatatgatcttttttattcttacaaagcataaaattacaaagagaactctttatgggagatcaacggctattattattataaaattaattaacccctt |
32095415 |
T |
|
| Q |
113 |
tacattatcaaagactattataacacaagaaatcaaactatcctagcttttatgcatactacataggcatcagaaatagttgttttatttatgtccctct |
212 |
Q |
| |
|
|||||||||||||||||||||||||||| | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32095414 |
tacattatcaaagactattataacacaacatatcaaactatcctagcttttatgcatactacataggcatcagaaatagttgttttatttatgtccctct |
32095315 |
T |
|
| Q |
213 |
caaatataattgttctcttattcccaaatgaagatatagctagtaagtccattcctttggaagaaatatcctttgagaacattgcttctgagatataaaa |
312 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32095314 |
caaatataattgttctcttattcccaaatgaagagatagctagtaagtccattcctttggaagaaatatcctttgagaacattgcttctgagatataaaa |
32095215 |
T |
|
| Q |
313 |
ct |
314 |
Q |
| |
|
|| |
|
|
| T |
32095214 |
ct |
32095213 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University