View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15195_low_38 (Length: 292)
Name: NF15195_low_38
Description: NF15195
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15195_low_38 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 165; Significance: 3e-88; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 165; E-Value: 3e-88
Query Start/End: Original strand, 108 - 276
Target Start/End: Complemental strand, 29572011 - 29571843
Alignment:
| Q |
108 |
gaactagaatttcatttggtattattattggaacttcttcagtgaataactcattcattagttccattgttgagtcaaaaattggtgtcataatttggtc |
207 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29572011 |
gaactagaatttcatttggtataattattggaacttcttcagtgaataactcattcattagttccattgttgagtcaaaaattggtgtcataatttggtc |
29571912 |
T |
|
| Q |
208 |
ttgttctttagcttcagttattgttgatgactcaaatgatgtttctggtttttgtggttccttgttttt |
276 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29571911 |
ttgttctttagcttcagttattgttgatgactcaaatgatgtttctggtttttgtggttccttgttttt |
29571843 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 19 - 49
Target Start/End: Complemental strand, 29572100 - 29572070
Alignment:
| Q |
19 |
atcagggagaagcaagtcttcaaggaagtta |
49 |
Q |
| |
|
||||||||||||||||||||||||||||||| |
|
|
| T |
29572100 |
atcagggagaagcaagtcttcaaggaagtta |
29572070 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University