View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15195_low_48 (Length: 249)
Name: NF15195_low_48
Description: NF15195
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15195_low_48 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 194; Significance: 1e-105; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 194; E-Value: 1e-105
Query Start/End: Original strand, 9 - 247
Target Start/End: Original strand, 43906937 - 43907174
Alignment:
| Q |
9 |
tttatgattctgttgttgtttctaattgnnnnnnnnggaaaattaacagcaaaaattgcttgaagttgattaagacaagattagaaacaataaggaagaa |
108 |
Q |
| |
|
|||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
43906937 |
tttatgattctgttgttgtttctaattgttttttt-ggaaaattaacagcaaaaattgcttgaagttgataaagacaagattagaaacaataaggaagaa |
43907035 |
T |
 |
| Q |
109 |
gcgaaacgcagtgcaaaaatttcttacgaaagatcttgttgatcttctcaagaattctcttgaatacaacgcatatggaagggtaatctttaactttctt |
208 |
Q |
| |
|
|||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
43907036 |
gcgaaacgcagtgcaaaaatttcttaagaaagatcttgttgatcttctcaagaattctcttgaatacaatgcatatggaagggtaatctttaactttctt |
43907135 |
T |
 |
| Q |
209 |
gtaaattttgattcattcttaattaattttcttcgacat |
247 |
Q |
| |
|
||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
43907136 |
gtaaattttgattcattcttaattaattttctttgacat |
43907174 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University