View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15195_low_51 (Length: 243)
Name: NF15195_low_51
Description: NF15195
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15195_low_51 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 125; Significance: 2e-64; HSPs: 3)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 125; E-Value: 2e-64
Query Start/End: Original strand, 89 - 217
Target Start/End: Complemental strand, 43599940 - 43599812
Alignment:
| Q |
89 |
gtgccaatttacaggagatcaacgacattgcagatatccaagaatgaatggttcaccaatgttgaggggtatttgtttctaatgaataggtgactccaga |
188 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43599940 |
gtgccaatttacaggagatcaacgacattgcagatatccaagaatgaatggttcaccaatgttgaggggtatttgtttctaatgaataggtgactccaga |
43599841 |
T |
 |
| Q |
189 |
tgctttgatttgccgtgcaataaagttac |
217 |
Q |
| |
|
||||||||||||| ||||||||||||||| |
|
|
| T |
43599840 |
tgctttgatttgcagtgcaataaagttac |
43599812 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 125; E-Value: 2e-64
Query Start/End: Original strand, 89 - 217
Target Start/End: Complemental strand, 43605432 - 43605304
Alignment:
| Q |
89 |
gtgccaatttacaggagatcaacgacattgcagatatccaagaatgaatggttcaccaatgttgaggggtatttgtttctaatgaataggtgactccaga |
188 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43605432 |
gtgccaatttacaggagatcaacgacattgcagatatccaagaatgaatggttcaccaatgttgaggggtatttgtttctaatgaataggtgactccaga |
43605333 |
T |
 |
| Q |
189 |
tgctttgatttgccgtgcaataaagttac |
217 |
Q |
| |
|
||||||||||||| ||||||||||||||| |
|
|
| T |
43605332 |
tgctttgatttgcagtgcaataaagttac |
43605304 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #3
Raw Score: 125; E-Value: 2e-64
Query Start/End: Original strand, 89 - 217
Target Start/End: Complemental strand, 43610924 - 43610796
Alignment:
| Q |
89 |
gtgccaatttacaggagatcaacgacattgcagatatccaagaatgaatggttcaccaatgttgaggggtatttgtttctaatgaataggtgactccaga |
188 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43610924 |
gtgccaatttacaggagatcaacgacattgcagatatccaagaatgaatggttcaccaatgttgaggggtatttgtttctaatgaataggtgactccaga |
43610825 |
T |
 |
| Q |
189 |
tgctttgatttgccgtgcaataaagttac |
217 |
Q |
| |
|
||||||||||||| ||||||||||||||| |
|
|
| T |
43610824 |
tgctttgatttgcagtgcaataaagttac |
43610796 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 121; Significance: 4e-62; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 121; E-Value: 4e-62
Query Start/End: Original strand, 89 - 217
Target Start/End: Original strand, 55338451 - 55338579
Alignment:
| Q |
89 |
gtgccaatttacaggagatcaacgacattgcagatatccaagaatgaatggttcaccaatgttgaggggtatttgtttctaatgaataggtgactccaga |
188 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
55338451 |
gtgccaatttacaggagatcaacgacattgcagatatccaagaatgaatggttcaccaatgttgaggggtatttgtttctaatgaataggtgactccaga |
55338550 |
T |
 |
| Q |
189 |
tgctttgatttgccgtgcaataaagttac |
217 |
Q |
| |
|
|||||||||||| ||||||||| |||||| |
|
|
| T |
55338551 |
tgctttgatttgtcgtgcaatacagttac |
55338579 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University