View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF15195_low_52 (Length: 240)

Name: NF15195_low_52
Description: NF15195
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF15195_low_52
NF15195_low_52
[»] chr2 (1 HSPs)
chr2 (1-155)||(43906713-43906867)


Alignment Details
Target: chr2 (Bit Score: 147; Significance: 1e-77; HSPs: 1)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 147; E-Value: 1e-77
Query Start/End: Original strand, 1 - 155
Target Start/End: Complemental strand, 43906867 - 43906713
Alignment:
1 ctttttggtttcaacaatccttgaaacattttcactctgagaaagaattgtattgaaacaggatccaaattaatgaggatgttaattgctatgttgaggt 100  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||  ||||    
43906867 ctttttggtttcaacaatccttgaaacattttcactctgagaaagaattgtattgaaacaggatccaaattaatgaggatgttaattgctatgtaaaggt 43906768  T
101 gaaaatgaaaaataggctgaaaataagaatgaacgttaaccttatataatatgtg 155  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||    
43906767 gaaaatgaaaaataggctgaaaataagaatgaacgttaaccttatataatatgtg 43906713  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University