View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15196_low_5 (Length: 257)
Name: NF15196_low_5
Description: NF15196
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15196_low_5 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 214; Significance: 1e-117; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 214; E-Value: 1e-117
Query Start/End: Original strand, 18 - 247
Target Start/End: Complemental strand, 40369487 - 40369259
Alignment:
| Q |
18 |
gtgtccactgaaatggaccatatttcaaattcaggagtgttaatcatacttatggagctttaatgcacgtgatgggcattagtgattaaagtgggctatt |
117 |
Q |
| |
|
|||||||||||||||||||||||||| ||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40369487 |
gtgtccactgaaatggaccatatttcgaattcag-agtgttaatcatacttatggagctttaatgcacgtgatgggcattagtgattaaagtgggctatt |
40369389 |
T |
|
| Q |
118 |
aatttgtgatcacatctactcgtgtgggtctaccaacacttattactcacacaaatatcaatcacattcagaatcagaattcagaacataaactctcgtt |
217 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40369388 |
aatttgtgatcacatctactcgtgtgggtctaccaacacttattactcacacaaatatcaatcacattcagaatcagaattcagaacataaactctcgtt |
40369289 |
T |
|
| Q |
218 |
gatatcatccatccttatttgtgtctgtgc |
247 |
Q |
| |
|
|||||||||||||||||||||||| ||||| |
|
|
| T |
40369288 |
gatatcatccatccttatttgtgtttgtgc |
40369259 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University