View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15197_high_14 (Length: 207)
Name: NF15197_high_14
Description: NF15197
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15197_high_14 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 91; Significance: 3e-44; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 91; E-Value: 3e-44
Query Start/End: Original strand, 1 - 107
Target Start/End: Original strand, 1114136 - 1114241
Alignment:
| Q |
1 |
atgttgcatcactagcctgcatgagaggattcaaaatccctaaatttgtctgctaataatctattttacacttagaaattatgttgttcttacaaatgga |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||| |||| ||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1114136 |
atgttgcatcactagcctgcatgagaggatccaaa-tccctaaatttgtatgctaataatctattttacacttagaaattatgttgttcttacaaatgga |
1114234 |
T |
 |
| Q |
101 |
atcccta |
107 |
Q |
| |
|
||||||| |
|
|
| T |
1114235 |
atcccta |
1114241 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 45; E-Value: 8e-17
Query Start/End: Original strand, 133 - 181
Target Start/End: Original strand, 1114266 - 1114314
Alignment:
| Q |
133 |
agaatccctagtacttatgaagtgagagattgattaatgttatatattt |
181 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
1114266 |
agaatccctagtacttatgaagtgagagattgattaatgttataaattt |
1114314 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University