View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF15197_high_7 (Length: 299)

Name: NF15197_high_7
Description: NF15197
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF15197_high_7
NF15197_high_7
[»] chr1 (1 HSPs)
chr1 (1-281)||(8158314-8158594)


Alignment Details
Target: chr1 (Bit Score: 281; Significance: 1e-157; HSPs: 1)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 281; E-Value: 1e-157
Query Start/End: Original strand, 1 - 281
Target Start/End: Complemental strand, 8158594 - 8158314
Alignment:
1 actggtaaaacaaattggtgaatcttcaggcttgccttctgggcaatcatcagtggaacatagccctaaaagatcaaagaggtttgaattagatttgaat 100  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
8158594 actggtaaaacaaattggtgaatcttcaggcttgccttctgggcaatcatcagtggaacatagccctaaaagatcaaagaggtttgaattagatttgaat 8158495  T
101 agtattggtgatgatggtgatacccaaccttcagatcagaggatggaggggcagctcttctttggaagaaatggctattggagcccatcacctgcatcat 200  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
8158494 agtattggtgatgatggtgatacccaaccttcagatcagaggatggaggggcagctcttctttggaagaaatggctattggagcccatcacctgcatcat 8158395  T
201 catcgtcgtcaatgcagccgtcagttcgaaacattgatttgaatgatagaccgtactttcaaactgatttactggaccaag 281  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
8158394 catcgtcgtcaatgcagccgtcagttcgaaacattgatttgaatgatagaccgtactttcaaactgatttactggaccaag 8158314  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University