View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15197_high_8 (Length: 273)
Name: NF15197_high_8
Description: NF15197
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15197_high_8 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 172; Significance: 2e-92; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 172; E-Value: 2e-92
Query Start/End: Original strand, 21 - 196
Target Start/End: Complemental strand, 11270242 - 11270067
Alignment:
| Q |
21 |
cccctctcgctctctcttgtttatcgcgtttttgttgctttcaatcattcatcaattttcactacctgtttaaatagaataaattatgctgatatagttt |
120 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
11270242 |
cccctctcgctctctcttgtttatcgcgtttttgttgctttcaatcattcatcaattttcactacctgtttaaatagaataaattatgctgatatagttt |
11270143 |
T |
 |
| Q |
121 |
aaatttcttcatcaatcaagactgtctttctcatgattaatcatagataggtgcgccaatactcaagtaagatgtg |
196 |
Q |
| |
|
|||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
11270142 |
aaatttattcatcaatcaagactgtctttctcatgattaatcatagataggtgcgccaatactcaagtaagatgtg |
11270067 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 55; E-Value: 1e-22
Query Start/End: Original strand, 208 - 262
Target Start/End: Complemental strand, 11269654 - 11269600
Alignment:
| Q |
208 |
cactatgctataagttattttgctagtacgagttaaaatttccatttgcattcat |
262 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
11269654 |
cactatgctataagttattttgctagtacgagttaaaatttccatttgcattcat |
11269600 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University