View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15197_high_9 (Length: 259)
Name: NF15197_high_9
Description: NF15197
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15197_high_9 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 100; Significance: 1e-49; HSPs: 5)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 100; E-Value: 1e-49
Query Start/End: Original strand, 1 - 122
Target Start/End: Complemental strand, 18515958 - 18515833
Alignment:
| Q |
1 |
agtgtttgcatactatagaggtgtgcacaaaccccagccttttagaggttaactgcagcatc---aatatttacg-aaaataaatcaacgtcattcattg |
96 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| |||||||||| |||||||||||||||||||||||| |
|
|
| T |
18515958 |
agtgtttgcatactatagaggtgtgcacaaaccccagccttttagaagttaactgcagcatcaataatatttacgaaaaataaatcaacgtcattcattg |
18515859 |
T |
|
| Q |
97 |
gagacactataggtagtataaccaac |
122 |
Q |
| |
|
|||||||||||||||||||||||||| |
|
|
| T |
18515858 |
gagacactataggtagtataaccaac |
18515833 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 71; E-Value: 3e-32
Query Start/End: Original strand, 169 - 243
Target Start/End: Complemental strand, 18515723 - 18515649
Alignment:
| Q |
169 |
ttacttgcaccaaagcgatccaaaatgagccatcaggagcaagattgatattatcaggtccaccagggaggtttt |
243 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
18515723 |
ttacttgcaccaaagcgatccaaaatgagccatcaggagcaagattgatattgtcaggtccaccagggaggtttt |
18515649 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #3
Raw Score: 40; E-Value: 0.00000000000009
Query Start/End: Original strand, 180 - 243
Target Start/End: Complemental strand, 18490825 - 18490762
Alignment:
| Q |
180 |
aaagcgatccaaaatgagccatcaggagcaagattgatattatcaggtccaccagggaggtttt |
243 |
Q |
| |
|
||||| ||||| ||||||||||||||||||||||| || |||||||||||| |||| ||||||| |
|
|
| T |
18490825 |
aaagcaatccagaatgagccatcaggagcaagattaatgttatcaggtccagcaggaaggtttt |
18490762 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #4
Raw Score: 40; E-Value: 0.00000000000009
Query Start/End: Original strand, 180 - 243
Target Start/End: Complemental strand, 18509333 - 18509270
Alignment:
| Q |
180 |
aaagcgatccaaaatgagccatcaggagcaagattgatattatcaggtccaccagggaggtttt |
243 |
Q |
| |
|
||||| ||||| ||||||||||||||||||||||| ||||||||||||||| | || ||||||| |
|
|
| T |
18509333 |
aaagcaatccagaatgagccatcaggagcaagattaatattatcaggtccagctggaaggtttt |
18509270 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #5
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 1 - 42
Target Start/End: Complemental strand, 18509952 - 18509911
Alignment:
| Q |
1 |
agtgtttgcatactatagaggtgtgcacaaaccccagccttt |
42 |
Q |
| |
|
|||||||| ||||| ||||||||||||||||||||| ||||| |
|
|
| T |
18509952 |
agtgtttggatactttagaggtgtgcacaaaccccatccttt |
18509911 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University