View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15197_low_13 (Length: 244)
Name: NF15197_low_13
Description: NF15197
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15197_low_13 |
 |  |
|
| [»] chr1 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 226; Significance: 1e-125; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 226; E-Value: 1e-125
Query Start/End: Original strand, 11 - 244
Target Start/End: Complemental strand, 8158882 - 8158649
Alignment:
| Q |
11 |
tggttctgatgatatgaatgtttctgcaaataccatgtctacaacaccgatacctgttgtctctgcttcaaaacctgcacagacttcaggattgccaaca |
110 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8158882 |
tggttctgatgatatgaatgtttctgcaaataccatatctacaacaccgatacctgttgtctctgcttcaaaacctgcacagacttcaggattgccaaca |
8158783 |
T |
 |
| Q |
111 |
gcccctctacagtttgaaggaacacttggatggaaaggttcggctgccaccagtgcctttcgtcctgcatcacctcgtaaaaatgctgataatcagaaga |
210 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8158782 |
gcccctctacagtttgaaggaacacttggatggaaagggtcggctgccaccagtgcctttcgtcctgcatcacctcgtaaaaatgctgataatcagaaga |
8158683 |
T |
 |
| Q |
211 |
atgtttctgctggtgggaactctgatatttccaa |
244 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |
|
|
| T |
8158682 |
atgtttctgctggtgggaactctgatatttccaa |
8158649 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University