View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15197_low_16 (Length: 219)
Name: NF15197_low_16
Description: NF15197
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15197_low_16 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 154; Significance: 7e-82; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 154; E-Value: 7e-82
Query Start/End: Original strand, 20 - 206
Target Start/End: Complemental strand, 21635324 - 21635130
Alignment:
| Q |
20 |
attaggctagattggatctttatttgtaaaccttaaagtcaataaacaaggtcaaaatcagacttataagttgtccttatgaggccacaaaacat----- |
114 |
Q |
| |
|
||||||| |||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
21635324 |
attaggcaagattggatctttatttgtaaaccttaaagtcaataaacaaggtcaaagtcagacttataagttgtccttatgaggccacaaaacataagca |
21635225 |
T |
 |
| Q |
115 |
---gtacatatatatttaggataaaacttacctataatatcataactgatataggtgctgttttttctcactaaaaatatcatgaaagttgagaa |
206 |
Q |
| |
|
||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
21635224 |
gtggtacatatatatttaggataaaacttatctataatatcataactgatataggtgctgttttttctcactaaaaatatcatgaaagttgagaa |
21635130 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University