View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15197_low_4 (Length: 392)
Name: NF15197_low_4
Description: NF15197
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15197_low_4 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 267; Significance: 1e-149; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 267; E-Value: 1e-149
Query Start/End: Original strand, 1 - 378
Target Start/End: Complemental strand, 5821458 - 5821084
Alignment:
| Q |
1 |
tatgttaatcctacgtcttccgggccagctaacttgcaacattcggacggtactgaaggtgggtttagtcgggtggattggttccagaaacccctatgga |
100 |
Q |
| |
|
|||||||||||||||||| ||||||||| ||||| |||||||| | ||||||||||| |||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5821458 |
tatgttaatcctacgtctgccgggccagataactcgcaacatttgaacggtactgaacgtgggtttagtcgggtggattggttccagaaacccctatgga |
5821359 |
T |
 |
| Q |
101 |
agtgcagccccatcctattctaagtaaagtggtgcaagatgatattgcggcaattcaccgatttatgcaatctacggcaggttactgtggttgatgatat |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| ||||||| |||||||||||||||||| || | | | | |
|
|
| T |
5821358 |
agtgcagccccatcctattctaagtaaagtggtgcaagatgatactgcggcaattcaccaatttatgaaatctacggcaggttactctgtaggttactgt |
5821259 |
T |
 |
| Q |
201 |
actaattaacctatttttgcattctgtgacagattacaagagtaaactgtgcaaattttcagcaagtaaaaaggaacgacttgaacggcttttacatgtc |
300 |
Q |
| |
|
| |||||||||||||||||||||||||||||||||||| ||||| |||| ||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5821258 |
ggt--ttaacctatttttgcattctgtgacagattacaagattaaacagtgc-aattttcagcaagtaaaaaggaacgacttgaacggcttttacatgtc |
5821162 |
T |
 |
| Q |
301 |
attgatgtcgatcttaactaacaagatatcttggttcttgatacttctgccaaatttttcaatgataattcaccactc |
378 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
5821161 |
attgatgtcgatcttaactaacaagatatctttgttcttgatacttctgccaaatttttcaatgagaattcaccactc |
5821084 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University