View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15198_low_5 (Length: 352)
Name: NF15198_low_5
Description: NF15198
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15198_low_5 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 330; Significance: 0; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 330; E-Value: 0
Query Start/End: Original strand, 1 - 342
Target Start/End: Complemental strand, 5333882 - 5333541
Alignment:
| Q |
1 |
ttgtccggccggtgattgacggtgaaccgatggatttctacgtgcggaagcgaccggggattgacgaattgttggaagcgttagcgttgaaatatgaggt |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
5333882 |
ttgtccggccggtgattgacggtgaaccgatggatttctacgtgcggaagcgaccggggattgacgaactgttggaagcgttagcgttgaaatatgaggt |
5333783 |
T |
|
| Q |
101 |
ggtggtttttacagctgcgttgaaggagtatgcgagtttggttgtggaccggctggaccggaatgggtttatttcgcatcggctttatagggattcgtgt |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5333782 |
ggtggtttttacagctgcgttgaaggagtatgcgagtttggttgtggaccggctggaccggaatgggtttatttcgcatcggctttatagggattcgtgt |
5333683 |
T |
|
| Q |
201 |
aggaatgttgatgggaagcttgtgaaagatttgggttttgtgggaagagatttgaagaaggttgttattgttgatgataatccagtttcgttttcgaatc |
300 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5333682 |
aggaatgttgatgggaagcttgtgaaagatttgggttttgtgggaagagatttgaagaaggttgttattgttgatgataatccagtttcgttttcgaatc |
5333583 |
T |
|
| Q |
301 |
aacctgcgaatgcaattttgattaagccttttgttgatgatg |
342 |
Q |
| |
|
||||||| ||||| |||||||||||||||||||||||||||| |
|
|
| T |
5333582 |
aacctgcaaatgcgattttgattaagccttttgttgatgatg |
5333541 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University