View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15198_low_7 (Length: 297)
Name: NF15198_low_7
Description: NF15198
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15198_low_7 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 242; Significance: 1e-134; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 242; E-Value: 1e-134
Query Start/End: Original strand, 5 - 285
Target Start/End: Original strand, 30320746 - 30321027
Alignment:
| Q |
5 |
tatattttagagtttcaacatacaaaaagttttatatcataaagagtatgctttcgaatacattacgattgcatatttgagttgt-gtcaaagtctatat |
103 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||| |||||||||||| | |
|
|
| T |
30320746 |
tatattttagagtttcaacatacaaaaagttttatatcataaagagtatgctttcgaatatattacgattgcatatttgagttgtagtcaaagtctatgt |
30320845 |
T |
|
| Q |
104 |
tgttttagcaactcaccatgtattgcgtgaaagaaacatcaaactctacaattttttataatctattttggccattcttttgaaattgtgctcattgtga |
203 |
Q |
| |
|
||||||| |||||| |||||||||| |||||||||||||||||||||||||| |||||||||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
30320846 |
tgttttatcaactcgccatgtattgtgtgaaagaaacatcaaactctacaatattttataatctattttggacattcttttgaaattgtgctcattgtga |
30320945 |
T |
|
| Q |
204 |
atagcaacactctttgacataacatgtgtttgttttggcgatgaaaaatcaattgtagacgttaaccatgggttgagaatga |
285 |
Q |
| |
|
|||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30320946 |
atagcaacgctctttgacataacatgtgtttgttttggcgatgaaaaatcaattgtagacgttaaccatgggttgagaatga |
30321027 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 1 - 64
Target Start/End: Original strand, 30320663 - 30320726
Alignment:
| Q |
1 |
aaattatattttagagtttcaacatacaaaaagttttatatcataaagagtatgctttcgaata |
64 |
Q |
| |
|
||||||||||||| |||||||||||||||||| ||||||| || ||||||||| |||||||| |
|
|
| T |
30320663 |
aaattatattttaaagtttcaacatacaaaaaaatttatattatgaagagtatgtcttcgaata |
30320726 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University