View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1519_high_103 (Length: 238)
Name: NF1519_high_103
Description: NF1519
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1519_high_103 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 96; Significance: 3e-47; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 96; E-Value: 3e-47
Query Start/End: Original strand, 85 - 188
Target Start/End: Complemental strand, 49277263 - 49277160
Alignment:
| Q |
85 |
tgaaaagtttattctttttcgcacacaattcccagcaaacaatgaatagtgttatttgttttaggtcttttgccacaggtatacatgtcatattgttgag |
184 |
Q |
| |
|
|||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
49277263 |
tgaaaaatttattctttttcgcacacaattcccagcaaacaatgaatagtgttatttgttttaggtcttttgccacaggtatacatgtcatattgttgaa |
49277164 |
T |
 |
| Q |
185 |
ttag |
188 |
Q |
| |
|
|||| |
|
|
| T |
49277163 |
ttag |
49277160 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 18 - 81
Target Start/End: Complemental strand, 49277364 - 49277301
Alignment:
| Q |
18 |
acctttatgtctactatctgtctcaaatttatctgtgttctannnnnnncctacacttttatta |
81 |
Q |
| |
|
||||||||||||| |||||||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
49277364 |
acctttatgtctaatatctgtctcaaatttatctgtgttctatttttttcctacacttttatta |
49277301 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University