View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1519_high_107 (Length: 236)
Name: NF1519_high_107
Description: NF1519
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1519_high_107 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 115; Significance: 2e-58; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 115; E-Value: 2e-58
Query Start/End: Original strand, 96 - 218
Target Start/End: Original strand, 38955509 - 38955631
Alignment:
| Q |
96 |
ataggccatgctccttgctggaacggactcatctgccgtaacattagagtggaccatgtcaaatattttgaactatccagaggtattgaaaaaggtaaga |
195 |
Q |
| |
|
|||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38955509 |
ataggcaatgctccttgctggaacggactcatctgccgtaacattagagtggaccatgtcaaatattttgaactatccagaggtattgaaaaaggtaaga |
38955608 |
T |
|
| Q |
196 |
gatgaagtggatacacatgtagg |
218 |
Q |
| |
|
|||||||||||||| |||||||| |
|
|
| T |
38955609 |
gatgaagtggatactcatgtagg |
38955631 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 103 - 147
Target Start/End: Complemental strand, 38975182 - 38975138
Alignment:
| Q |
103 |
atgctccttgctggaacggactcatctgccgtaacattagagtgg |
147 |
Q |
| |
|
||||| ||||||||||| |||||||| || ||||||||||||||| |
|
|
| T |
38975182 |
atgcttcttgctggaacagactcatcagctgtaacattagagtgg |
38975138 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University