View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1519_high_39 (Length: 379)
Name: NF1519_high_39
Description: NF1519
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1519_high_39 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 305; Significance: 1e-171; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 305; E-Value: 1e-171
Query Start/End: Original strand, 26 - 346
Target Start/End: Original strand, 23157484 - 23157804
Alignment:
| Q |
26 |
tcaagtttttatgttttgtgctttcaaataatgggaagcttttggttttatatttggtctttgaagttgtgagcgtgtgaaaaatggaaaagttcatcat |
125 |
Q |
| |
|
||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
23157484 |
tcaagtttttatgttttatgctttcaaataatgggaagcttttggttttatatttggtctttgaagttgtgagcgtgtgaaaaatggaaaagttcatcat |
23157583 |
T |
 |
| Q |
126 |
gcgcttggttagtttgtaatttaataattgtaattatgtgttaagaaattgttgaatatattgttctttatggccaaaagggtcacttgaagtatgagtt |
225 |
Q |
| |
|
||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
23157584 |
gcgcttggttagtttgtaaattaataattgtaattatgtgttaagaaattgttgaatatattgttctttatggccaaaagggtcacttgaagtatgagtt |
23157683 |
T |
 |
| Q |
226 |
tttaggcaaattgatgaacaaaatgtatgtaagtacacttctttggcctaatgggtcctaaagactatgggtttgttgaagaataattcgtatagtctac |
325 |
Q |
| |
|
| ||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
23157684 |
tctaggcaaattgataaacaaaatgtatgtaagtacacttctttggcctaatgggtcctaaagactatgggtttgttgaagaataattcgtatagtctac |
23157783 |
T |
 |
| Q |
326 |
aattgtgaatttttatctgtg |
346 |
Q |
| |
|
||||||||||||||||||||| |
|
|
| T |
23157784 |
aattgtgaatttttatctgtg |
23157804 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University