View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1519_high_55 (Length: 330)
Name: NF1519_high_55
Description: NF1519
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1519_high_55 |
 |  |
|
| [»] scaffold0543 (1 HSPs) |
 |  |  |
|
| [»] scaffold0492 (1 HSPs) |
 |  |  |
|
Alignment Details
Target: chr2 (Bit Score: 210; Significance: 1e-115; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 210; E-Value: 1e-115
Query Start/End: Original strand, 30 - 295
Target Start/End: Original strand, 33492611 - 33492875
Alignment:
| Q |
30 |
gataaatagtgtagtagcatcgtggtttcgctttatatagtttggtgataatttaaaattatttcacggcgcaacaacggtaattgcaaccatcataaac |
129 |
Q |
| |
|
||||||| |||||||| ||||||||||||||||||||||||||| ||| ||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33492611 |
gataaattgtgtagtaacatcgtggtttcgctttatatagtttg-tgaaaatttaaaattatttcacggcgcaacaacggtaattgcaaccatcataaac |
33492709 |
T |
 |
| Q |
130 |
gcaactgcgacacccaactttataagtgaccgcaaccgtgatttaaaactatgatcaagcatgacaatttatgagatataacaacgtcaaatccaatcaa |
229 |
Q |
| |
|
|||||||| ||||||||||||||| |||||||||||| |||||||||| ||||| ||||||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
33492710 |
gcaactgctacacccaactttatagatgaccgcaaccgcgatttaaaaccatgatgaagcatggcaatttatgagatataacaacgtcaaatccaatcaa |
33492809 |
T |
 |
| Q |
230 |
tgtacaagcatgtcaattacaacaagataatatagtcgtgaaatcaaactgcgtaatatttcatct |
295 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
33492810 |
tgtataagcatgtcaattacaacaagataatatagtcgtgaaatcaaactgcataatatttcatct |
33492875 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 37; E-Value: 0.000000000008
Query Start/End: Original strand, 30 - 106
Target Start/End: Original strand, 3975369 - 3975444
Alignment:
| Q |
30 |
gataaatagtgtagtagcatcgtggtttcgctttatatagtttggtgataatttaaaattatttcacggcgcaacaa |
106 |
Q |
| |
|
||||||||||||||||| || ||||| || ||||||||||||| |||| |||||||||| |||||||| ||||||| |
|
|
| T |
3975369 |
gataaatagtgtagtagtatggtggtgtcactttatatagttt-gtgaaaatttaaaatcatttcacgctgcaacaa |
3975444 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 46; Significance: 3e-17; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 46; E-Value: 3e-17
Query Start/End: Original strand, 30 - 107
Target Start/End: Original strand, 32520126 - 32520202
Alignment:
| Q |
30 |
gataaatagtgtagtagcatcgtggtttcgctttatatagtttggtgataatttaaaattatttcacggcgcaacaac |
107 |
Q |
| |
|
||||||||||||| |||||| ||||| || ||||||||||||| |||| ||||||||||||||||||| ||||||||| |
|
|
| T |
32520126 |
gataaatagtgtaatagcatggtggtgtcactttatatagttt-gtgaaaatttaaaattatttcacgccgcaacaac |
32520202 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0543 (Bit Score: 35; Significance: 0.0000000001; HSPs: 1)
Name: scaffold0543
Description:
Target: scaffold0543; HSP #1
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 31 - 97
Target Start/End: Original strand, 6283 - 6348
Alignment:
| Q |
31 |
ataaatagtgtagtagcatcgtggtttcgctttatatagtttggtgataatttaaaattatttcacg |
97 |
Q |
| |
|
|||||| |||||||||||| |||| |||||||||||||||| ||| ||||||||||||||||||| |
|
|
| T |
6283 |
ataaattgtgtagtagcatgctggtgtcgctttatatagttt-ttgaaaatttaaaattatttcacg |
6348 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0492 (Bit Score: 35; Significance: 0.0000000001; HSPs: 1)
Name: scaffold0492
Description:
Target: scaffold0492; HSP #1
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 31 - 97
Target Start/End: Original strand, 7828 - 7893
Alignment:
| Q |
31 |
ataaatagtgtagtagcatcgtggtttcgctttatatagtttggtgataatttaaaattatttcacg |
97 |
Q |
| |
|
|||||| |||||||||||| |||| |||||||||||||||| ||| ||||||||||||||||||| |
|
|
| T |
7828 |
ataaattgtgtagtagcatgctggtgtcgctttatatagttt-ttgaaaatttaaaattatttcacg |
7893 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University