View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1519_high_60 (Length: 322)
Name: NF1519_high_60
Description: NF1519
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1519_high_60 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 177; Significance: 2e-95; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 177; E-Value: 2e-95
Query Start/End: Original strand, 11 - 308
Target Start/End: Complemental strand, 23585630 - 23585332
Alignment:
| Q |
11 |
aaaataaaataaatcagggtaggcagatgttaccccnnnnnnnnnn-gaaaaattgggtagcatctgtccatgtttatatcccctcataaatggtgtatg |
109 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |||||||||| |||||||||||||| |||||||||||||||||||||| |
|
|
| T |
23585630 |
aaaataaaataaatcagggtaggcagatgttaccccattttttttttgaaaaattggatagcatctgtccatatttatatcccctcataaatggt----- |
23585536 |
T |
|
| Q |
110 |
atggttttgtcgacacttcctatgcatggactttcaaccaaatcgctctggtggaactgttgacgggctcgtctataacacactatatataccttaagga |
209 |
Q |
| |
|
||| ||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
23585535 |
-----tttatcgacgcttcctatgcatggactttcaaccaaatcgctctggtggaactgttgacgggctcgtctataacacactatatataccttaagga |
23585441 |
T |
|
| Q |
210 |
aattttttgg----------gggtttgattaatattcttttactatttcaaatataatcgatcattgttgttccataatattagttttttatattttaac |
299 |
Q |
| |
|
|||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
23585440 |
aattttttggtaatgcttataggtttgattaatattcttttactatttcaaatataatcgatcattgttgttccataatattagttttttatatgttaac |
23585341 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University