View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1519_high_67 (Length: 311)
Name: NF1519_high_67
Description: NF1519
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1519_high_67 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 35; Significance: 0.0000000001; HSPs: 3)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 192 - 234
Target Start/End: Complemental strand, 46910565 - 46910523
Alignment:
| Q |
192 |
aagaccatccccaatttgccacactatatttctttaaaactcc |
234 |
Q |
| |
|
||||||||||||||||| ||||||||||||||||| ||||||| |
|
|
| T |
46910565 |
aagaccatccccaattttccacactatatttctttgaaactcc |
46910523 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 90 - 119
Target Start/End: Original strand, 9588732 - 9588761
Alignment:
| Q |
90 |
agggtatgatttatcaattataccctttgt |
119 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
9588732 |
agggtatgatttatcaattataccctttgt |
9588761 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #3
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 90 - 119
Target Start/End: Complemental strand, 21959780 - 21959751
Alignment:
| Q |
90 |
agggtatgatttatcaattataccctttgt |
119 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
21959780 |
agggtatgatttatcaattataccctttgt |
21959751 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 33; Significance: 0.000000002; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 90 - 122
Target Start/End: Original strand, 25400459 - 25400491
Alignment:
| Q |
90 |
agggtatgatttatcaattataccctttgttaa |
122 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |
|
|
| T |
25400459 |
agggtatgatttatcaattataccctttgttaa |
25400491 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 90 - 122
Target Start/End: Original strand, 25496638 - 25496670
Alignment:
| Q |
90 |
agggtatgatttatcaattataccctttgttaa |
122 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |
|
|
| T |
25496638 |
agggtatgatttatcaattataccctttgttaa |
25496670 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 33; Significance: 0.000000002; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 192 - 260
Target Start/End: Original strand, 27892856 - 27892924
Alignment:
| Q |
192 |
aagaccatccccaatttgccacactatatttctttaaaactcctcccagcatagcaagggctttccaca |
260 |
Q |
| |
|
||||||||| |||||||| |||||||||||| ||| ||||||| | |||||||||||||||||||| |
|
|
| T |
27892856 |
aagaccatctccaatttgtcacactatatttttttgaaactcccctgctcatagcaagggctttccaca |
27892924 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 192 - 232
Target Start/End: Complemental strand, 24190036 - 24189996
Alignment:
| Q |
192 |
aagaccatccccaatttgccacactatatttctttaaaact |
232 |
Q |
| |
|
|||||||||| |||||||||| ||||||||||||| ||||| |
|
|
| T |
24190036 |
aagaccatcctcaatttgccaaactatatttctttgaaact |
24189996 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 30; Significance: 0.0000001; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 90 - 119
Target Start/End: Complemental strand, 37371504 - 37371475
Alignment:
| Q |
90 |
agggtatgatttatcaattataccctttgt |
119 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
37371504 |
agggtatgatttatcaattataccctttgt |
37371475 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University