View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1519_high_69 (Length: 295)
Name: NF1519_high_69
Description: NF1519
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1519_high_69 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 262; Significance: 1e-146; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 262; E-Value: 1e-146
Query Start/End: Original strand, 11 - 280
Target Start/End: Original strand, 8000292 - 8000561
Alignment:
| Q |
11 |
cataggaggatcatccatggaagtagtgcctaggattacttctctttttagttttgttgtcagtttatgacaaacacgtagctgaaaataaaagtaataa |
110 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8000292 |
cataggaggatcatccatggaagtagtgcctaggattacttctctttttagttttgttgtcagtttatgacaaacacgtagctgaaaataaaagtaataa |
8000391 |
T |
 |
| Q |
111 |
tatcataagatgggactacaattgcaacatcccgaatatggatgcagaagttctttatcaaattttacctcagatcgagtagccccgccaataataaaca |
210 |
Q |
| |
|
||||||||||||||| ||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8000392 |
tatcataagatgggattacaaatgcaacatcccgaatatggatgcagaagttctttatcaaattttacctcagatcgagtagccccgccaataataaaca |
8000491 |
T |
 |
| Q |
211 |
caaagatccgctttcccatcttcttgaaatcagcagccacgttctttaacgtggagtcactaaagaagat |
280 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8000492 |
caaagatccgctttcccatcttcttgaaatcagcagccacgttctttaacgtggagtcactaaagaagat |
8000561 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University